Hermansyah, Hermansyah (2021) Transcription of cell wall mannoproteins-1 gene in Saccharomyces cerevisiae mutant (Peer Review). Fakultas MIPA, Universitas Sriwijaya, Unsri. (Unpublished)
Preview |
Text
PeerReview_Transcription of Cell Wall Mannoproteins-1 gene in.pdf Download (938kB) | Preview |
Abstract
Protein phosphatase (PPases) are enzymes to catalyze the phosphate groups removal from amino acid residues of proteins by protein kinases. The PPG1, one of PPases in Saccharomyces cerevisiae has less information in function/role. In this research, the disruption of PPG1::CgHIS3 in FY833 genetic background was successfully constructed by PCR-mediated disruption strategies using pCgHIS3 (EcoRI-HindIII) (=pYMS314) (pUC19 base) and primer pair of PPG1, forward (41 to 100) and reverse (1048 to 1101). A BamHI - BamHI fragment 3,28 kb PPG1::CgHIS3 consisting of 1 kb upstream PPG1+ 1.78 kb CgHIS3 + 0.5 down stream of PPG1) was confirmed using PCR and detected using electrophoresis. Phenotypic assay of PPG1::CgHIS3 in FY833 and did not show 200 g/ml Calco fluor sensitivity, while another mutant PPG1::CgHIS3 in W303-IA show 100 g/ml congo red sensitivity. Furthermore, to confirm whether PPG1 could increase a CWP1 transcriptional level was performed Real Time (RT) PCR analysis using Primer pair Kf (AATTCGGCCTGGTGAGTATCC) and Kr (GTTTCAAAGTGCCGTTATCACT GT). RT-PCR’s data showed that transcriptional level of CWP1 in PPG1::CgHIS3 changed less than two-folds comparing with in wild type strain. This result indicated that disruption of PPG1 in S.cerevisiae did not change CWP1 transcriptional level significantly.
| Item Type: | Other |
|---|---|
| Subjects: | Q Science > QD Chemistry > QD415-436 Biochemistry |
| Divisions: | 08-Faculty of Mathematics and Natural Science > 47201-Chemistry (S1) |
| Depositing User: | Hermansyah Hermansyah |
| Date Deposited: | 26 Aug 2020 16:21 |
| Last Modified: | 17 Sep 2021 15:29 |
| URI: | http://repository.unsri.ac.id/id/eprint/33846 |
Actions (login required)
 |
View Item |